fdhD

Information for fdhD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4080352-4083402 - CDS fdoG EG11858 formate dehydrogenase-O; major subunit 4083596-4084429 + CDS fdhD EG11859 affects formate dehydrogenase-N 4084582-4085637 + CDS yiiG EG11860 orf; hypothetical protein

Reported regulatory sites for fdhD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 8.915 4083481-4083502 ttttt CTTTGCGGAAGGGGCCGCAAAG gtcca - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.325 4083546-4083564 tttgt AACAGAATACCATAATGTT ggtgt - 0 - 4.003 4083574-4083595 tgtgt GTTCTTATCTGGTTAAGAGAAA gtgaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back