fdnG

Information for fdnG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1544312-1545193 - CDS yddG EG12713 orf; hypothetical protein 1545425-1548472 + CDS fdnG EG11227 formate dehydrogenase-N; nitrate-inducible; alpha subunit 1548485-1549369 + CDS fdnH EG11228 formate dehydrogenase-N; nitrate-inducible; iron-sulfur beta subunit

Reported regulatory sites for fdnG: Genome coordinates Source Transcription factor Transcription factor annotation 1545343-1545364 DPInteract fnr transcriptional regulation of aerobic anaerobic respiration osmotic balance 1545284-1545299 DPInteract narL pleiotrophic regulation of anaerobic respiration: response regulator for nar frd dms and tor genes 1545284-1545299 DPInteract narP nitrate/nitrite response regulator (sensor NarQ)

Species with an ortholog: HI PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.599 1545345-1545362 gttct TTTTGATTTCGCGCAAAA agatt fnr 18 - 1.319 1545234-1545252 agctg AATTTTATAGCATTTTTTT aactg - 0 - 1.159 1545376-1545399 aattt TACTGTTAGTTTCCTCGCGCAGTA atacc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back