fdoG

Information for fdoG, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4079437-4080339 - CDS fdoH EG11857 formate dehydrogenase-O; iron-sulfur subunit 4080352-4083402 - CDS fdoG EG11858 formate dehydrogenase-O; major subunit 4083596-4084429 + CDS fdhD EG11859 affects formate dehydrogenase-N

Reported regulatory sites for fdoG: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.597 4083423-4083444 R aagcg AATGTAAATGGGACGTGACAAT gtcga - 0 - 2.560 4083579-4083595 R ttcac TTTCTCTTAACCAGATA agaac - 0 - 1.831 4083546-4083564 R acacc AACATTATGGTATTCTGTT acaaa - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back