fdrA

Information for fdrA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 544538-545587 - CDS ylbC EG13624 putative malate dehydrogenase (EC 1.1.1.37) 545904-547571 + CDS fdrA EG13399 involved in protein transport; multicopy suppressor of dominant negative ftsH mutants 547838-548839 + CDS ylbE EG13398 orf; hypothetical protein

Reported regulatory sites for fdrA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.211 545871-545889 cgtgc AATTGCCATGGGTGCAATT tttaa - 0 - 4.009 545681-545704 aaata TAGTTAGAATTTATTTGATAATCC gctca - 0 - 4.009 545772-545795 ggtgg TTATTTGAATTCTTTTGTTAATAA ttcct - 0 - 3.543 545596-545616 tcttc CTTTTTAACGACGGTGTGAAG catga - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back