feaB

Information for feaB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1444402-1445307 - CDS feaR EG13422 regulatory protein for 2-phenylethylamine catabolism 1445540-1447042 + CDS feaB EG13179 phenylacetaldehyde dehydrogenase 1447100-1449373 - CDS tynA EG13140 copper amine oxidase (tyramine oxidase)

Reported regulatory sites for feaB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.646 1445322-1445342 tcgct CTGTGAAATGTATTTTTATTG ttgca - 0 - 0.646 1445475-1445495 cacag CGAAAAAAGTGACTTTTCTTG tcgct - 0 - 0.044 1445410-1445432 gcata GAGACATAAGCGGTTATTGTCAC gattt - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back