fecI

Information for fecI, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4514332-4515285 - CDS fecR EG10292 regulator for fec operon; periplasmic 4515282-4515803 - CDS fecI EG10291 probable RNA polymerase sigma factor 4516095-4516370 + CDS insA_7 - IS1 protein InsA

Reported regulatory sites for fecI: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.257 4515846-4515862 R ttgta ATGATAACCATTCTCAT attaa - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.754 4515965-4515987 R acatc ATGAGTCATTCTGACCGACACAT gccag - 0 -

Critical MAP values: p=0.01 3.34 p=0.05 2.41 p=0.1 2.01 p=0.2 1.55

Click here to go back