feoA

Information for feoA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3535122-3537344 + CDS yhgF EG12932 orf; hypothetical protein 3537799-3538026 + CDS feoA EG12101 ferrous iron transport protein A 3538043-3540364 + CDS feoB EG12102 ferrous iron transport protein B

Reported regulatory sites for feoA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.958 3537670-3537688 ataga AACCATTCTCATTATCATT gtgtt - 0 - 3.880 3537524-3537545 acaac TGAAACCTTAATTAAACATTAG ccagt - 0 - 2.893 3537504-3537526 caata TTTATCATTTCATTAACAACTGA aacct - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back