fepA

Information for fepA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 608682-609311 - CDS entD EG10262 enterochelin synthetase; component D 609477-611717 - CDS fepA EG10293 outer membrane receptor for ferric enterobactin (enterochelin) and colicins B and D 612038-613162 + CDS fes EG10299 enterochelin esterase

Reported regulatory sites for fepA: Genome coordinates Source Transcription factor Transcription factor annotation 611878-611895 DPInteract fur negative regulator

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.846 611896-611916 R tgcag AAATATATTGATAATATTATT gataa - 0 - 4.549 611872-611890 R gataa CTATTTGCATTTGCAATAG cgtaa fur 13 - 3.835 611854-611877 R atttg CAATAGCGTAATGGCGCGCCGTGG gaagc - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back