fepB

Information for fepB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 621523-622773 + CDS ybdA EG11104 putative transport 622777-623733 - CDS fepB EG10294 ferric enterobactin (enterochelin) binding protein; periplasmic component 624108-625283 + CDS entC EG10261 isochorismate hydroxymutase 2; enterochelin biosynthesis

Reported regulatory sites for fepB: Genome coordinates Source Transcription factor Transcription factor annotation 623945-623962 DPInteract fur negative regulator 624060-624077 DPInteract fur negative regulator

Species with an ortholog: PA ST EC VC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.425 624064-624080 R aggct TTAATAATGATTATCAT ttata fur 14 - 4.425 623943-623959 R tgaaa ATGAGAAGCATTATTGA tggat fur 15 - 1.130 624038-624058 R ttata TTTTCGGTCGCTAACCTAAAA gcaaa - 0 - 0.474 623982-623998 R caatc TGCAACTCGGGGTTGCA tctgg - 0 - -

Critical MAP values: p=0.01 6.09 p=0.05 4.94 p=0.1 4.37 p=0.2 3.74

Click here to go back