fepE

Information for fepE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 613380-617261 + CDS entF EG10264 ATP-dependent serine activating enzyme (may be part of enterobactin synthase as component F) 617477-618610 + CDS fepE EG10297 ferric enterobactin (enterochelin) transport 618607-619422 - CDS fepC EG10295 ATP-binding component of ferric enterobactin transport

Reported regulatory sites for fepE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.124 617295-617315 cagaa AATAATTATGGGTTTTTTATT tgttt - 0 - 1.070 617268-617291 ttaat ATTATTTATAAACCCATAATTACA gaaaa - 0 - 0.725 617395-617415 acttc AGCTTCGGATAATTATCACCA actgg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back