fes

Information for fes, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 609477-611717 - CDS fepA EG10293 outer membrane receptor for ferric enterobactin (enterochelin) and colicins B and D 612038-613162 + CDS fes EG10299 enterochelin esterase 613380-617261 + CDS entF EG10264 ATP-dependent serine activating enzyme (may be part of enterobactin synthase as component F)

Reported regulatory sites for fes: Genome coordinates Source Transcription factor Transcription factor annotation 611878-611895 DPInteract fur negative regulator

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.318 611892-611911 atagt TATCAATAATATTATCAATA tattt fur 4 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.501 611872-611890 ttacg CTATTGCAAATGCAAATAG ttatc fur 13 - 3.950 611937-611960 aattg CACAGTAAACATGGGGTTATGGTG tgacg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back