ffh

Information for ffh, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2743957-2744205 - CDS rpsP EG10915 30S ribosomal subunit protein S16 2744454-2745815 - CDS ffh EG10300 GTP-binding export factor binds to signal sequence; GTP and RNA 2745907-2746773 + CDS b2611 EG14226 orf; hypothetical protein

Reported regulatory sites for ffh: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.001 2745841-2745860 R gatga TGTGTCGCGATTGCGGCCAA ccgtt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.583 2745871-2745891 R acgcc TTCATGTTATACTGCGGCAAA atact - 0 - 1.570 2745855-2745876 R actgc GGCAAAATACTGATGATGTGTC gcgat - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back