fhuA

Information for fhuA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 164730-167264 + CDS mrcB EG10605 peptidoglycan synthetase; penicillin-binding protein 1B 167484-169727 + CDS fhuA EG10302 outer membrane protein receptor for ferrichrome; colicin M; and phages T1; T5; and phi80 169778-170575 + CDS fhuC EG10304 ATP-binding component of hydroxymate-dependent iron transport

Reported regulatory sites for fhuA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.331 167417-167438 cgaat ATTATCTTATCTTTATAATAAT cattc - 0 - 2.038 167302-167318 ccatc CGGTAAAATAACATCCC atcta - 0 REPt12 (4) 2.038 167348-167364 tcatc TGGTTGTTTATTAACCC ttcag - 0 - 2.016 167447-167467 tctcg TTTACGTTATCATTCACTTTA catca - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back