fhuE

Information for fhuE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1157092-1158525 + CDS ptsG EG10787 PTS system; glucose-specific IIBC component 1158585-1160774 - CDS fhuE EG10306 outer membrane receptor for ferric iron uptake 1161108-1161467 + CDS ycfF EG12172 orf; hypothetical protein

Reported regulatory sites for fhuE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.354 1160945-1160965 R cgtat ATATCGCCATTATTCCCATTT ctgcc - 0 - 3.354 1160870-1160890 R aatat GAATGCGTATATTTCTCATTT gcatt - 0 - 1.560 1161048-1161066 R atgct ACGCCGCGCCACACTGCGA gtata - 0 - 0.921 1160986-1161009 R caacc TTAACTCACGATTTCTTAAGCAAA aaatc - 0 - 0.921 1160843-1160866 R ttgca TTTACAAACAAAATTATTCGCACA ctaaa - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back