fimB

Information for fimB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4536353-4537078 - CDS yjhA EG12389 orf; hypothetical protein 4538525-4539127 + CDS fimB EG10309 recombinase involved in phase variation; regulator for fimA 4539605-4540201 + CDS fimE EG10312 recombinase involved in phase variation; regulator for fimA

Reported regulatory sites for fimB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.092 4538143-4538164 ggagt TGACTAATAATGTCATATGTGA gacgg - 0 - 1.092 4538227-4538248 ttaca GAACATATCACATGATATATAG ataag - 0 - 0.699 4538175-4538198 ctagt TGAACGAATATTAAATTTTGCTGA atttt - 0 - 0.243 4538054-4538077 aggaa TAATCGCTAGGGACCTAAGAATTA gcatg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back