fimZ
 
Information for fimZ, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
562553-563068
+
CDS
putative fimbrial-like protein
563071-563703
-
CDS
fimZ
fimbrial Z protein; probable signal transducer
563946-564022
+
tRNA
Arginine tRNA4
 
Reported regulatory sites for fimZ:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: ST PA YP EC
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
1.820
563751-563770 R
cgtat TTTCATGTATCAAAGTACAA tttcc
-
0
-
0.359
563811-563834 R
tctga TTTATTTCGCTATAGCGGCAAACA aacgc
-
0
-
0.120
563792-563809 R
aacaa ACGCACACCGCTGCGCGT ctgaa
-
0
-
 
Critical MAP values:
p=0.01
6.66
p=0.05
5.31
p=0.1
4.59
p=0.2
3.95

Click here to go back