fimZ

Information for fimZ, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 562553-563068 + CDS sfmF EG12388 putative fimbrial-like protein 563071-563703 - CDS fimZ EG11103 fimbrial Z protein; probable signal transducer 563946-564022 + tRNA argU EG30014 Arginine tRNA4

Reported regulatory sites for fimZ: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST PA YP EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.820 563751-563770 R cgtat TTTCATGTATCAAAGTACAA tttcc - 0 - 0.359 563811-563834 R tctga TTTATTTCGCTATAGCGGCAAACA aacgc - 0 - 0.120 563792-563809 R aacaa ACGCACACCGCTGCGCGT ctgaa - 0 -

Critical MAP values: p=0.01 6.66 p=0.05 5.31 p=0.1 4.59 p=0.2 3.95

Click here to go back