fixA

Information for fixA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 40417-41931 - CDS caiT EG11561 probable carnitine transporter 42367-43173 + CDS fixA EG11562 probable flavoprotein subunit; carnitine metabolism 43188-44129 + CDS fixB EG11563 probable flavoprotein subunit; carnitine metabolism

Reported regulatory sites for fixA: Genome coordinates Source Transcription factor Transcription factor annotation 42245-42266 PMID: 9573142 crp cyclic AMP receptor protein 42188-42209 PMID: 9573142 crp cyclic AMP receptor protein 42235-42280 PMID: 10564497 caiF transcriptional regulator of cai operon 42178-42231 PMID: 10564497 caiF transcriptional regulator of cai operon

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.951 42318-42335 taaag TTTTATTTCAAAATTAAA gggcg - 0 - 5.491 42237-42252 ccgtg TTTTCAATATTGGTGA ggaac caiF crp 16 8 - 5.491 42296-42311 tgaca TTTTCAATATTGGTGA ttaaa - 0 - 4.143 42199-42218 gatcc ATAAAACAATATTGAAAATT tcttt caiF crp 20 11 - 4.143 42256-42275 gagga ACTTAACAATATTGAAAGTT ggatt caiF crp 20 11 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back