fkpA

Information for fkpA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3473355-3474089 - CDS yheO EG12899 orf; hypothetical protein 3474244-3475056 - CDS fkpA EG12900 FKBP-type peptidyl-prolyl cis-trans isomerase (rotamase) 3475277-3475495 + CDS slyX EG11664 host factor for lysis of phiX174 infection

Reported regulatory sites for fkpA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.807 3475172-3475194 R atcga AACTAATTTAAACAAAAAGAGTC tgaaa - 0 - 2.239 3475110-3475131 R gattt GTTCGACAACGCTTTATAGTAC ccttc - 0 - 1.812 3475072-3475088 R aaccc TGGGGTGAGATGCCCCG atcct - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back