fldA

Information for fldA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 709423-709869 - CDS fur EG10359 negative regulator 710158-710688 - CDS fldA EG10318 flavodoxin 1 710828-711190 - CDS ybfE EG11775 orf; hypothetical protein

Reported regulatory sites for fldA: Genome coordinates Source Transcription factor Transcription factor annotation 710796-710816 PMID: 10419964 soxS regulation of superoxide response regulon

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.803 710732-710753 R ctatg ATTGCCTTTATCCGTGGGCAAT tttcc - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.867 710791-710811 R catgt AGCACAGTGTGCAGTCCTGCT cgttt soxS 16 - 3.867 710757-710777 R gattc CGCAAGACTGCCTGTTCTGCT atgat - 0 - 2.882 710696-710714 R tttca ATAAGTTTCAAGAGGTTAT ttcac - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back