flgH

Information for flgH, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1133952-1134734 + CDS flgG EG14271 flagellar biosynthesis; cell-distal portion of basal-body rod 1134787-1135485 + CDS flgH EG20264 flagellar biosynthesis; basal-body outer-membrane L (lipopolysaccharide layer) ring protein 1135497-1136594 + CDS flgI EG20265 homolog of Salmonella P-ring of flagella basal body

Reported regulatory sites for flgH: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.850 1134764-1134784 ggttt ACTGATTTTTGAAGATGATAG ccatg - 0 - 1.045 1134739-1134755 aggct TAACCGGTGGCAGGTTC accgg - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back