flgK

Information for flgK, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1136594-1137535 + CDS flgJ EG14272 flagellar biosynthesis 1137601-1139244 + CDS flgK EG11967 flagellar biosynthesis; hook-filament junction protein 1 1139256-1140209 + CDS flgL EG11545 flagellar biosynthesis; hook-filament junction protein

Reported regulatory sites for flgK: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.222 1137580-1137600 taatt GAAGGCTTATAAGGAACCTCC atgtc - 0 - 2.269 1137544-1137566 actca AGTCCGGCGGGTCGCTGCCGATA atact - 0 - 1.661 1137562-1137583 gctgc CGATAATACTCTGTAATTGAAG gctta - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back