flgK
 
Information for flgK, and also upstream and downstream flanking genes:
Genome coordinates
Orientation
Gene type
Name
EcoGene
Annotation
1136594-1137535
+
CDS
flagellar biosynthesis
1137601-1139244
+
CDS
flgK
flagellar biosynthesis; hook-filament junction protein 1
1139256-1140209
+
CDS
flagellar biosynthesis; hook-filament junction protein
 
Reported regulatory sites for flgK:
Genome coordinates
Source
Transcription factor
Transcription factor annotation
 
Species with an ortholog: PA SP ST EC VC YP
 
Predictions with an average map value >= the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
 
Predictions with an average map value < the critical MAP value (p=0.05):
Avg. MAP
Genome coordinates
Sequence
Site type
Overlap (bp)
Repeat
Model logo
Prediction logo
Prediction alignment
3.222
1137580-1137600
taatt GAAGGCTTATAAGGAACCTCC atgtc
-
0
-
2.269
1137544-1137566
actca AGTCCGGCGGGTCGCTGCCGATA atact
-
0
-
1.661
1137562-1137583
gctgc CGATAATACTCTGTAATTGAAG gctta
-
0
-
 
Critical MAP values:
p=0.01
5.41
p=0.05
4.01
p=0.1
3.43
p=0.2
2.86

Click here to go back