flhD

Information for flhD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1975290-1975868 - CDS flhC EG10319 regulator of flagellar biosynthesis acting on class 2 operons; transcription initiation factor 1975871-1976230 - CDS flhD EG10320 regulator of flagellar biosynthesis; acting on class 2 operons; transcriptional initiation factor 1976542-1977045 - CDS insB_5 - IS1 protein InsB

Reported regulatory sites for flhD: Genome coordinates Source Transcription factor Transcription factor annotation 1976475-1976502 PMID: 10601207 crp cyclic AMP receptor protein 1976354-1976419 PMID: 7642497 ompR response regulator (sensor EnvZ) affecting transcription of ompC and ompF: outer membrane protein synthesis

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.845 1976278-1976301 R ttatt TTTTACCGGGGCTTCCCGGCGACA tcacg - 0 - 4.625 1976232-1976253 R cgcat AAAAATAAAGTTGGTTATTCTG ggtgg - 0 - 4.105 1976480-1976501 R gtgtt TTGTGTGATCTGCATCACGCAT tattg crp 22 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back