fliA

Information for fliA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1998496-1999083 - CDS fliZ EG11356 orf; hypothetical protein 1999093-1999812 - CDS fliA EG11355 flagellar biosynthesis; alternative sigma factor 28; regulation of flagellar operons 2000133-2001629 - CDS fliC EG10321 flagellar biosynthesis; flagellin; filament structural protein

Reported regulatory sites for fliA: Genome coordinates Source Transcription factor Transcription factor annotation 1999888-1999918 DPInteract flhCD regulator of flagellar biosynthesis acting on class 2 operons; transcription initiation factor

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.519 2000066-2000088 R aattg CCTGATGCGCTGCGCTTATCAGG cctac - 0 REPv141b (23) 1.459 1999820-1999842 R atgcc GATAACTCATATAACGCAGGGCT gttta - 0 - 1.283 2000034-2000056 R caagt TGAATTGCAATTTATTGAATTTG cacat - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back