fliD

Information for fliD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2000133-2001629 - CDS fliC EG10321 flagellar biosynthesis; flagellin; filament structural protein 2001895-2003301 + CDS fliD EG10841 flagellar biosynthesis; filament capping protein; enables filament assembly 2003326-2003736 + CDS fliS EG11388 flagellar biosynthesis; repressor of class 3a and 3b operons (RflA activity)

Reported regulatory sites for fliD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.149 2001756-2001776 gccat TTTTTGTTAGTCGCCGAAATA ctctt - 0 - 1.418 2001820-2001838 caatt AAACGTAAACTTTGCGCAA ttcag - 0 - 1.033 2001693-2001713 caatc GCCGTCAACCCTGTTATCGTC tgtcg - 0 - 1.033 2001844-2001864 ttcag ACCGATAACCCCGGTATTCGT tttac - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back