fliE

Information for fliE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2010524-2010802 + CDS b1936 EG14259 orf; hypothetical protein 2010722-2011036 - CDS fliE EG11346 flagellar biosynthesis; basal-body component; possibly at (MS-ring)-rod junction 2011251-2012909 + CDS fliF EG11347 flagellar biosynthesis; basal-body MS(membrane and supramembrane)-ring and collar protein

Reported regulatory sites for fliE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.041 2011191-2011207 R aaagt GGAACAAGACTCACTCC cgggt - 0 - 3.851 2011153-2011174 R actcg AAAAATTGACGCTCCCATTATT tgtgc - 0 - 3.398 2011175-2011190 R actcc CGGGTCAGCAAACTCG aaaaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back