fliL

Information for fliL, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2016408-2017535 + CDS fliK EG20268 flagellar hook-length control protein 2017640-2018104 + CDS fliL EG10322 flagellar biosynthesis 2018109-2019113 + CDS fliM EG10323 flagellar biosynthesis; component of motor switch and energizing; enabling rotation and determining its direction

Reported regulatory sites for fliL: Genome coordinates Source Transcription factor Transcription factor annotation 2017542-2017572 DPInteract flhCD regulator of flagellar biosynthesis acting on class 2 operons; transcription initiation factor

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.933 2017551-2017568 agcac CGTAATCCGCGTCTTTTC cccgc flhCD 18 - 2.933 2017595-2017612 cgcag GATAATTAGCCGATAAGC agtag - 0 - 2.487 2017573-2017594 ccccg CTTTGTTGCGCTCAAGACGCAG gataa - 0 - 1.526 2017619-2017637 gtagc GACACAGGAAGACCGCAAC acatg - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back