fliO

Information for fliO, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2019110-2019523 + CDS fliN EG10324 flagellar biosynthesis; component of motor switch and energizing; enabling rotation and determining its direction 2019586-2019891 + CDS fliO EG11224 flagellar biosynthesis 2019891-2020628 + CDS fliP EG11975 flagellar biosynthesis

Reported regulatory sites for fliO: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.985 2019569-2019585 ttctg CTGCGCCACTGCTGCAG gtgag - 0 - - 0.090 2019547-2019566 ctgtg CAATCTTCCGCGCCGGTTTC tgctg - 0 -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back