fnr

Information for fnr, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1395696-1396646 - CDS ydaA EG11246 orf; hypothetical protein 1396798-1397550 - CDS fnr EG10325 transcriptional regulation of aerobic; anaerobic respiration; osmotic balance 1397745-1398260 - CDS ogt EG10668 O-6-alkylguanine-DNA/cysteine-protein methyltransferase

Reported regulatory sites for fnr: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.687 1397669-1397690 R cttaa CAACTTAAGGGTTTTCAAATAG ataga - 0 - 4.687 1397566-1397587 R atgtt AAAATTGACAAATATCAATTAC ggctt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.073 1397702-1397724 R tgcca GCTTGTTCACACTTTTATGTAAA gttac - 0 - 0.680 1397595-1397618 R gtttg CTTAGACTTACTTGCTCCCTAAAA agatg - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back