focA

Information for focA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 950495-952777 - CDS pflB EG10701 formate acetyltransferase 1 952832-953689 - CDS focA EG11258 probable formate transporter (formate channel 1) 954095-955864 - CDS ycaO EG13699 orf; hypothetical protein

Reported regulatory sites for focA: Genome coordinates Source Transcription factor Transcription factor annotation 953908-953998 PMID: 7565118 arcA negative response regulator of genes in aerobic pathways (sensors ArcB and CpxA) 953818-953847 DPInteract & PMID: 8376324 ihf integration host factor (IHF) 953746-953767 RegulonDB & PMID: 8709852 fnr transcriptional regulation of aerobic anaerobic respiration osmotic balance 953717-953741 PMID: 7601827 narL pleiotrophic regulation of anaerobic respiration: response regulator for nar frd dms and tor genes 953794-953821 PMID: 7601827 narL pleiotrophic regulation of anaerobic respiration: response regulator for nar frd dms and tor genes 953960-953997 PMID: 7601827 narL pleiotrophic regulation of anaerobic respiration: response regulator for nar frd dms and tor genes 954053-954069 PMID: 7601827 narL pleiotrophic regulation of anaerobic respiration: response regulator for nar frd dms and tor genes

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.314 953747-953766 R ggcga GATATGATCTATATCAATTT ctcat fnr 20 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.486 953704-953724 R gttag TATCTCGTCGCCGACTTAATA aagag narL 8 - 2.935 953719-953742 R tctca TCTATAATGCTTTGTTAGTATCTC gtcgc narL 23 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back