folD

Information for folD, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 555884-556117 - CDS ybcJ EG12879 orf; hypothetical protein 556098-556964 - CDS folD EG10328 5;10-methylene-tetrahydrofolate dehydrogenase; 5;10-methylene-tetrahydrofolate cyclohydrolase 557402-557977 + CDS sfmA EG13881 putative fimbrial-like protein

Reported regulatory sites for folD: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.150 557016-557037 R aacct GACAGCGCGCCCCGCTTCTGAC aaaat - 0 - 1.963 557036-557052 R ataaa TCTGAAACGAAACCTGA cagcg - 0 - 1.759 557066-557085 R gcgcc TCACCTTCGCAAGAGGTCGC ttcac - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back