folE

Information for folE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2239830-2240987 - CDS yeiB EG11290 orf; hypothetical protein 2241004-2241672 - CDS folE EG11375 GTP cyclohydrolase I 2241930-2242766 + CDS yeiG EG12026 putative esterase (EC 3.1.1.-).

Reported regulatory sites for folE: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.080 2241687-2241710 R cccac GCAGGGCGGAGGCGTCACACCTGC aggag - 0 - 2.098 2241749-2241772 R tggat TATGTGCGCCGCCTCACGCACAAT aatca - 0 - 1.890 2241863-2241884 R accgt TTATTCAATGTGCTGTGAGTAA ctttc - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back