folX

Information for folX, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2418641-2419288 + CDS yfcG EG14110 putative S-transferase 2419345-2419707 + CDS folX EG14263 D-erythro-7;8-dihydroneopterin tri P epimerase 2419728-2420621 + CDS b2304 EG14111 putative sugar nucleotide epimerase

Reported regulatory sites for folX: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.115 2419288-2419311 agtta ACAGAAACAGGTTCTCGTGTATTA tttca - 0 - 0.000 2419312-2419328 tatta TTTCATCCTAAGTAAAA caacg - 0 -

Critical MAP values: p=0.01 3.18 p=0.05 2.36 p=0.1 2.00 p=0.2 1.60

Click here to go back