fpr

Information for fpr, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4110873-4111301 + CDS yiiT EG11877 putative regulator 4111306-4112052 - CDS fpr EG11518 ferredoxin-NADP reductase 4112149-4113159 - CDS glpX EG11517 unknown function in glycerol metabolism

Reported regulatory sites for fpr: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.035 4112107-4112128 R gagcc TTCCAGTCCTTCGGGACTGGAA ttttt - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 0.919 4112083-4112105 R ggaat TTTTTTGTTCGGAGAACGAAGAT aaggc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back