fruB

Information for fruB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2259447-2260385 - CDS fruK EG10337 fructose-1-phosphate kinase 2260385-2261515 - CDS fruB EG10005 PTS system; fructose-specific IIA/fpr component 2261883-2263064 + CDS yeiO EG12034 putative transport

Reported regulatory sites for fruB: Genome coordinates Source Transcription factor Transcription factor annotation 2261602-2261617 DPInteract fruR transcriptional repressor of fru operon and others 2261535-2261550 DPInteract fruR transcriptional repressor of fru operon and others

Species with an ortholog: HI PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 7.194 2261602-2261617 R gcttt CTTGAAACGTTTCAGC gcgat fruR 16 - 7.194 2261535-2261550 R tagag GCTGAATCGTTTCAAT tcagc fruR 16 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.313 2261828-2261851 R cgcgg AGTTTACGCTGCTTGTCAGAAAAT aaaca - 0 - 2.313 2261671-2261694 R gcaaa AAATTGTGCAGCACATCAAACTTT tgctc - 0 - 1.280 2261632-2261647 R tttcc TTGCGTGCTGAAACAG aagta - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back