fruR

Information for fruR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 87860-87946 + CDS fruL - fruR leader peptide 88028-89032 + CDS fruR EG10338 transcriptional repressor of fru operon and others 89634-90092 + CDS yabB EG11084 orf; hypothetical protein

Reported regulatory sites for fruR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.522 87958-87981 gcgct TAGATGTTAATGAATTTAACCCAT accag - 0 - 1.809 87732-87755 tagca GGCACCAGCGGTAAGCTTGATGCA ttttt - 0 - 1.809 87985-88008 atacc AGTACAATGGCTATGGTTTTTACA tttta - 0 - 1.536 87916-87935 gtggg AACCTGGAATAAAAGCAGTT gccgc - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back