frwC

Information for frwC, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4139437-4139766 + CDS yijI - orf; hypothetical protein 4140109-4141188 + CDS frwC EG11908 PTS system; fructose-like enzyme II component 4141203-4141523 + CDS frwB EG11909 PTS system fructose-like IIB component 1

Reported regulatory sites for frwC: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.471 4139820-4139840 tacgg TTTTCTGTTTACAGGATAAGA gcgca - 0 - 2.471 4139982-4140002 cgcat TTTTGTACTGATATTACAAAA gtcca - 0 - 1.581 4139846-4139869 gcgca CGGCAACGGCCTGCCATGTGACAA atctg - 0 - 1.080 4140089-4140105 gcttt CGCAAGCCCGGGAGCAG cttat - 0 -

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back