fsr

Information for fsr, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 500786-502462 - CDS ybaL EG12623 putative transport protein 502700-503920 - CDS fsr EG13268 fosmidomycin resistance protein 504138-505790 + CDS ushA EG11060 UDP-sugar hydrolase (5'-nucleotidase)

Reported regulatory sites for fsr: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.600 503970-503991 R tacag GTATGTTAGTCTGGTAATAATC acaaa - 0 - 2.425 504102-504119 R acctg ATTTCAACGTGTTGAAAA atagt - 0 - 1.655 504033-504055 R agata AATCTGCATCCAGATTAGAAATT ctgta - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back