fumB

Information for fumB, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 4342507-4343136 - CDS yjdF EG12463 orf; hypothetical protein 4343258-4344904 - CDS fumB EG10357 fumarase B= fumarate hydratase Class I; anaerobic isozyme 4344982-4346322 - CDS dcuB EG10006 anaerobic dicarboxylate transport

Reported regulatory sites for fumB: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 6.428 4344947-4344970 R tttgc GTGCCGCCCGTGACTACGCGGCAC gccat - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.342 4344906-4344922 R tacag AGTTACAGGCTGGAAGC tatgt - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back