fur

Information for fur, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 709013-709339 + CDS ybfN EG13660 orf; hypothetical protein 709423-709869 - CDS fur EG10359 negative regulator 710158-710688 - CDS fldA EG10318 flavodoxin 1

Reported regulatory sites for fur: Genome coordinates Source Transcription factor Transcription factor annotation 710006-710027 DPInteract crp cyclic AMP receptor protein 709935-709952 DPInteract fur negative regulator 710080-710126 PMID: 10419964 oxyR activator hydrogen peroxide-inducible genes

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.083 710081-710096 R taatt GCTACAAATTTGTAAC ttttg oxyR 16 - 3.639 710101-710117 R aatag ATAATGCCAATCAAAAT aattg oxyR 17 - 3.639 709935-709951 R attct ATAATGATACGCATTAT ctcaa fur 17 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.780 710049-710069 R tgttg TACCTGTACAATGTCCCGGTG ttcaa - 0 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back