gabP

Information for gabP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2790756-2792036 + CDS gabT EG10361 4-aminobutyrate aminotransferase activity 2792274-2793674 + CDS gabP EG11330 transport permease protein of gamma-aminobutyrate 2793677-2794357 + CDS ygaE EG12386 putative transcriptional regulator

Reported regulatory sites for gabP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.388 2792069-2792084 gcgcg TCTTGTCCGGCCTACG gggat - 0 REP191a (15) 2.388 2792152-2792167 atcta TGTTGGCCGGGTAAGG cggag - 0 REP191c (15) 1.071 2792097-2792120 aggtc GGATAAGGCGTTTACGCCGCATCC gacaa - 0 REP191b (24) 0.406 2792037-2792060 agtag CGCCGCTCCTATGCCGGAGGCGAC gctgc - 0 REP191a (12) 0.406 2792215-2792238 cgtga CCCGGCGCGGGAAATGTCGGGGCG ctctc - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back