galE

Information for galE, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 789206-790252 - CDS galT EG10366 galactose-1-phosphate uridylyltransferase 790262-791278 - CDS galE EG10362 UDP-galactose-4-epimerase 791539-793011 - CDS modF EG11677 ATP-binding component of molybdate transport system

Reported regulatory sites for galE: Genome coordinates Source Transcription factor Transcription factor annotation 791335-791356 DPInteract crp cyclic AMP receptor protein 791357-791372 DPInteract galR repressor of galETK operon 791244-791259 DPInteract galR repressor of galETK operon

Species with an ortholog: HI PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.170 791356-791373 R attct TGTGTAAACGATTCCACT aattt crp galR 1 16 - 2.170 791298-791315 R atgct ATGGTTATTTCATACCAT aagcc - 0 - 1.960 791440-791456 R cgcgt CTTTTTTCAGATAAAAA gcgca - 0 - 1.960 791387-791403 R atcac TTAATCGCGCATAAAAA acggc - 0 - 1.698 791334-791355 R ccact AATTTATTCCATGTCACACTTT tcgca crp 21 -

Critical MAP values: p=0.01 4.80 p=0.05 3.45 p=0.1 2.95 p=0.2 2.42

Click here to go back