galF

Information for galF, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2109998-2111083 - CDS rfbB EG12412 dTDP-glucose 4;6 dehydratase 2111456-2112349 - CDS galF EG13578 homolog of Salmonella UTP--glucose-1-P uridyltransferase; probably a UDP-gal transferase 2112524-2113918 - CDS wcaM EG12651 orf; hypothetical protein

Reported regulatory sites for galF: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.940 2112501-2112523 R agtag ATTTGCGACCATTCCTGGAAAAA tggag - 0 - 3.425 2112421-2112439 R acaag TAATTCAGTAATCAATTCA gggta - 0 - 3.425 2112365-2112383 R agcta TAATTCAGCAACCATTTTA caggt - 0 - 1.950 2112396-2112417 R caggg TAATTGATGCTGGCGAAAAAAA tcgaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back