galU

Information for galU, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1289465-1290478 + CDS hnr EG12121 Hnr protein 1290680-1291588 + CDS galU EG11319 glucose-1-phosphate uridylyltransferase 1291732-1292145 - CDS hns EG10457 DNA-binding protein HLP-II (HU; BH2; HD; NS); pleiotropic regulator

Reported regulatory sites for galU: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI SP ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.074 1290551-1290569 tcgta TAAGTAATTGTCTTAATTA tgcta - 0 - 2.031 1290660-1290676 acacg AACAGTCCAGGAGAATT taaat - 0 - 1.777 1290636-1290657 tacag AAATATGAACACGTTCAAAACA cgaac - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back