gatR_2

Information for gatR_2, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2168554-2169420 + CDS tra5_4 - IS3 putative transposase 2169417-2169755 - CDS gatR_2 EG12162 split galactitol utilization operon repressor; fragment 2 2169855-2170895 - CDS gatD EG12417 galactitol-1-phosphate dehydrogenase

Reported regulatory sites for gatR_2: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.372 2169830-2169846 R cgcgg GCCAGCGTGATGCTGGC ccggt - 0 - - 1.063 2169775-2169790 R tcccc CTTCGTTTACACTAGC cacaa - 0 - 0.407 2169793-2169812 R aaaac AGATCATTCACCAATGGTCC ccctt - 0 - -

Critical MAP values: p=0.01 7.59 p=0.05 6.45 p=0.1 5.76 p=0.2 5.04

Click here to go back