gatY

Information for gatY, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2173079-2174341 - CDS gatZ EG12418 putative tagatose 6-phosphate kinase 1 2174370-2175230 - CDS gatY EG12419 tagatose-bisphosphate aldolase 1 2175532-2176656 - CDS b2097 EG14062 orf; hypothetical protein

Reported regulatory sites for gatY: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 1.374 2175271-2175292 R tcgtt ATCTCGATATTTAAAAACAAAT aattt - 0 - 1.358 2175285-2175304 R tcgtt TTTGTGATCGTTATCTCGAT attta - 0 - 1.101 2175257-2175279 R attta AAAACAAATAATTTCATTATATT ttgaa - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back