gcd

Information for gcd, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 137083-138633 + CDS yacK EG12318 orf; hypothetical protein 138835-141225 - CDS gcd EG10369 glucose dehydrogenase 141419-141967 + CDS hpt EG20098 hypoxanthine phosphoribosyltransferase

Reported regulatory sites for gcd: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA ST EC

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 5.880 141285-141304 R ctcga ATTGTGATGACGATCACACA tgtta - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 3.976 141399-141418 R accat ATGATTTAAAAACAAATCAC ttcgc - 0 - 3.976 141251-141270 R ctata ATTAATTGCTACTAAAATAT taatg - 0 - 2.194 141325-141346 R tatac CAGTAAAACTATTCATTCGCGG aatct - 0 -

Critical MAP values: p=0.01 6.82 p=0.05 5.66 p=0.1 5.03 p=0.2 4.36

Click here to go back