gcl

Information for gcl, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 532235-533050 + CDS ybbU EG13616 putative regulator 533140-534921 + CDS gcl EG11583 glyoxylate carboligase 534934-535710 + CDS gip EG11584 glyoxylate-induced protein

Reported regulatory sites for gcl: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.974 533060-533083 tgtcg CATCCCGCTCTGCGGAGCGGGTTT ttttg - 0 -

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.246 533091-533114 ttgac AAAATTTGAAAGTTGGAAAAATTT tccaa - 0 - 0.869 533115-533131 aattt TCCAATAAATAGAGGTA ggaat - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back