gcvP

Information for gcvP, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 3043178-3043921 - CDS ygfF EG12971 putative oxidoreductase 3044188-3047061 - CDS gcvP EG11810 glycine decarboxylase; P protein of glycine cleavage system 3047180-3047569 - CDS gcvH EG10371 in glycine cleavage complex; carrier of aminomethyl moiety via covalently bound lipoyl cofactor

Reported regulatory sites for gcvP: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: PA SP ST EC VC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.646 3047071-3047089 R acaat TCACTGCACGTTTCAGGAA ccatc - 0 - 0.596 3047159-3047179 R agtaa CGGCTTTATTCCTCTTCTGCG ggaga - 0 BOXC17 (13)

Critical MAP values: p=0.01 5.41 p=0.05 4.01 p=0.1 3.43 p=0.2 2.86

Click here to go back