gcvR

Information for gcvR, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 2596902-2597780 - CDS dapA EG10205 dihydrodipicolinate synthase 2597860-2598498 + CDS gcvR EG11149 transcriptional regulation of gcv operon 2598498-2598968 + CDS bcp EG10108 bacterioferritin comigratory protein

Reported regulatory sites for gcvR: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 4.745 2597788-2597803 gccat CCTCTGTGCAAACAAG tgtct - 0 - 3.677 2597808-2597823 gtgtc TCAATGGTACGTTTGG tatgg - 0 - 2.928 2597816-2597838 atggt ACGTTTGGTATGGCATTAAAAGC aagca - 0 -

Critical MAP values: p=0.01 7.30 p=0.05 6.05 p=0.1 5.26 p=0.2 4.60

Click here to go back