gdhA

Information for gdhA, and also upstream and downstream flanking genes:

Genome coordinates Orientation Gene type Name EcoGene Annotation 1839887-1840159 - CDS b1760 EG14010 orf; hypothetical protein 1840395-1841738 + CDS gdhA EG10372 NADP-specific glutamate dehydrogenase 1841855-1843018 - CDS b1762 EG14011 orf; hypothetical protein

Reported regulatory sites for gdhA: Genome coordinates Source Transcription factor Transcription factor annotation

Species with an ortholog: HI PA ST EC YP

Predictions with an average map value >= the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment

Predictions with an average map value < the critical MAP value (p=0.05): Avg. MAP Genome coordinates Sequence Site type Overlap (bp) Repeat Model logo Prediction logo Prediction alignment 2.885 1840374-1840392 tatta ATATATAAGGGTTTTATAT ctatg - 0 - 1.736 1840282-1840305 ctggg TCATTTTTTTCTTGCTTACCGTCA cattc - 0 - 1.736 1840312-1840335 attct TGATGGTATAGTCGAAAACTGCAA aagca - 0 - 0.416 1840230-1840250 tctga GTTATCGCATTTGGTTATGAG attac - 0 -

Critical MAP values: p=0.01 6.03 p=0.05 4.63 p=0.1 3.98 p=0.2 3.37

Click here to go back